View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6636_low_48 (Length: 228)
Name: NF6636_low_48
Description: NF6636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6636_low_48 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 39 - 228
Target Start/End: Complemental strand, 38712193 - 38712009
Alignment:
| Q |
39 |
gtgaagagttacctcgaatgattaatcatgcacaaaagaatactttgannnnnnnnnnnnnatatataatatacggccaacaaattcaacatcccaagac |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38712193 |
gtgaagagttacctcgaatgattaatcatgcacaaaagaatactttgattttttta-----atatataatatacggccaacaaattcaacatcccgagac |
38712099 |
T |
 |
| Q |
139 |
tctgagccaaaaacaaagtggttgaacaatcactgagtaacttcaaaattaaaaattgcatccaaaaataccaaaagtggaaatggttga |
228 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38712098 |
tctgagccaaaaagaaagtggttgaacaatcaccgagtaacttcaaaattaaaaattgcatccaaaaataccaaaagtggaattggttga |
38712009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University