View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6636_low_50 (Length: 217)
Name: NF6636_low_50
Description: NF6636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6636_low_50 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 88 - 217
Target Start/End: Original strand, 28954905 - 28955034
Alignment:
| Q |
88 |
gtaccaattgtgtctaattttgctatgaattcaaataaatcaacccaagacaatgatttgtggagaaattaacaaagacaatcaacaatcaaacaactca |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28954905 |
gtaccaattgtgtctaattttgctatgaattcaaataaatcaacccaagacaatgatttgtggagaaattaacaaacacaatcaacaatcaaacaactca |
28955004 |
T |
|
| Q |
188 |
tggaacaatattcaatcaagattaaaccaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28955005 |
aggaacaatattcaatcaagattaaaccaa |
28955034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 44 - 77
Target Start/End: Original strand, 28954857 - 28954890
Alignment:
| Q |
44 |
ggaaagtagattgtattgttatgcttatctattg |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
28954857 |
ggaaagtagattgtattgttatgcttatctattg |
28954890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University