View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6637_high_13 (Length: 213)
Name: NF6637_high_13
Description: NF6637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6637_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 2e-63; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 6284536 - 6284662
Alignment:
| Q |
1 |
acacaccttatatacaagtaaaaatattgagagaacaactaaagatttctcttgatgaatagcataattgattatagggtctacggattaaatttagttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6284536 |
acacaccttatatacaagtaaaaatattgagagaacaactaaagatttctcttgatgaataacataattgattatagggtctacggattaaatttagttc |
6284635 |
T |
 |
| Q |
101 |
taacatttttctctaaaaattatattc |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
6284636 |
taacatttttctctaaaaattatattc |
6284662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 135 - 209
Target Start/End: Original strand, 6285050 - 6285124
Alignment:
| Q |
135 |
aacaccacagtgacacctttaatcatactgaattatatcgttttctcaaattattattggtgtccattttatgta |
209 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6285050 |
aacaccacagtgacacctataatcatattgaattatattgttttctcaaattattattggtgtccattttatgta |
6285124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 147 - 195
Target Start/End: Original strand, 36386219 - 36386267
Alignment:
| Q |
147 |
acacctttaatcatactgaattatatcgttttctcaaattattattggt |
195 |
Q |
| |
|
||||||||||| | |||||||||| || ||||||||||||||||||||| |
|
|
| T |
36386219 |
acacctttaattacactgaattatgtccttttctcaaattattattggt |
36386267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 197
Target Start/End: Original strand, 50848325 - 50848361
Alignment:
| Q |
161 |
actgaattatatcgttttctcaaattattattggtgt |
197 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
50848325 |
actgaattatatcattttttcaaattattattggtgt |
50848361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 161 - 198
Target Start/End: Original strand, 23128683 - 23128720
Alignment:
| Q |
161 |
actgaattatatcgttttctcaaattattattggtgtc |
198 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23128683 |
actgaattatatggttttctcaaattattattggtgtc |
23128720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 146 - 198
Target Start/End: Original strand, 21140989 - 21141041
Alignment:
| Q |
146 |
gacacctttaatcatactgaattatatcgttttctcaaattattattggtgtc |
198 |
Q |
| |
|
||||||| |||||| |||||||||||| |||||| ||||||||| ||||||| |
|
|
| T |
21140989 |
gacacctataatcacactgaattatatgattttcttaaattattagtggtgtc |
21141041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 163 - 196
Target Start/End: Original strand, 1893393 - 1893426
Alignment:
| Q |
163 |
tgaattatatcgttttctcaaattattattggtg |
196 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
1893393 |
tgaattatatcattttctcaaattattattggtg |
1893426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University