View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6637_high_2 (Length: 444)
Name: NF6637_high_2
Description: NF6637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6637_high_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 185 - 426
Target Start/End: Original strand, 24991043 - 24991284
Alignment:
| Q |
185 |
tgtttatgaacatcatcagtatcacatacctgctaacacccctaaaccttgaacttctcttcacagtggttgcagtggattgaccagtcactggctgctg |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24991043 |
tgtttatgaacatcatcagtatcacatacctgctaacacccctaaaccttgaacttctcttcacagtggttgcagtggattgaccactcactggctgctg |
24991142 |
T |
|
| Q |
285 |
tatttctgatacatcgccttgttgttcattgccacctaacacagatgattctcttcgccgccttttaacagatttagtagttacaacagaatcagtatcc |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24991143 |
tatttctgatacatcgccttgttgttcattgccacctaataccgatgattctcttcgccgccttttaacagatttagtagttacaacagaatcagtatcc |
24991242 |
T |
|
| Q |
385 |
agcatgagcaatctatgacttcttggacttagttcagatttc |
426 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24991243 |
agcatgagcaatctatgacttcttggacttagttcagatttc |
24991284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 24990864 - 24991014
Alignment:
| Q |
1 |
actaccggatatgacctcga-actaacattggtatgtcggcattgataatgattt--aaattttaattaattctaaattggtaatcataatatgtgtcgg |
97 |
Q |
| |
|
||||||||||||| | | || |||||||||||||||||||||||||||||||||| ||| | ||||||||| |||||||||||| ||||||| |
|
|
| T |
24990864 |
actaccggatatggcattgatactaacattggtatgtcggcattgataatgatttgaaaaatataattaatt--------gtaatcataataagtgtcgg |
24990955 |
T |
|
| Q |
98 |
tgtcagacaacgaacaacaaaccttctatcacaagtgtcggtgttacagacctaacaat |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24990956 |
tgtcagacaacgaacaacaaaccttctatcacaagtgtcggtgttacagagctaacaat |
24991014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University