View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6637_high_3 (Length: 357)
Name: NF6637_high_3
Description: NF6637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6637_high_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 22 - 342
Target Start/End: Complemental strand, 3842871 - 3842547
Alignment:
| Q |
22 |
ccgccggtgcctcacctcattctcatatgcctcccagttcatttgctggtgcttttcctggtagtcaacctcattatggttgggaaagtagatttcgtct |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3842871 |
ccgccggtgcctcacctcattctcatatgcctcccagttcatttgccggtgcttttcctggtagtcaacctcattatggttgggaaagtagatttcgtct |
3842772 |
T |
|
| Q |
122 |
gaactacaatccctataccttataatttttattcaactccatcaaattttcaagttggatctcattgattcat--agagtttcagtttcaatttctgatg |
219 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3842771 |
gaactacaatccctataccttatagtttttattcaactccatcaaattttcaagttggatctcattgattcatacagagtttcagtttcaatttctgatg |
3842672 |
T |
|
| Q |
220 |
ccctaagttttgtgccttttctccaaattacccactattttcgggtattgtctttacttactacatgga--nnnnnnnnnnctcgtttattttcggtatt |
317 |
Q |
| |
|
|||||||||||| ||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||| |||||| |
|
|
| T |
3842671 |
ccctaagttttgagccttttgtccaaactacccactattttcgggtattgtctttacttactacatggattttttttttttcttgtttatttttggtatt |
3842572 |
T |
|
| Q |
318 |
tcttcatgctaacaacccttctgtg |
342 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3842571 |
tcttcatgctaacaacccttctgtg |
3842547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University