View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6637_high_5 (Length: 328)
Name: NF6637_high_5
Description: NF6637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6637_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 74 - 322
Target Start/End: Complemental strand, 32322319 - 32322078
Alignment:
| Q |
74 |
tgtgtacattcggtcgtgggaaaaaagtagctcggatttcactgggttctcacttctccggttgagggagaaaatccggaaccgtgttttactatatcat |
173 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32322319 |
tgtgtacgttcggtcgtgggaaacaagtagctcggatttcactgggttctc-------cggttgatggagaaaatccggaaccgtgttttactatatcat |
32322227 |
T |
|
| Q |
174 |
gaaagcagttatgtccatgaatgaggcaaaattgtgtaatccgcatgaccatgctccaaatgtcagttgaggactgtatataacagatggtctgcttgat |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32322226 |
gaaagcagttatgtccatgaatgaggcaaaattgtgtaatccgcatgaccatgctccaaatgtcagttgaggactgtatataacaaatggtctgcttgat |
32322127 |
T |
|
| Q |
274 |
gtgttattacgatttgcaatatttttgtttagttaaggtcttcatctca |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32322126 |
gtgttattacgatttgcaatatttttgtttagtaaaggtcttcatctca |
32322078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 157 - 213
Target Start/End: Complemental strand, 32320588 - 32320530
Alignment:
| Q |
157 |
gtgttttactatatcatgaaagcagttatgtccatga--atgaggcaaaattgtgtaat |
213 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||| | ||||| |||||||||||||| |
|
|
| T |
32320588 |
gtgttttactatatcatgaaagcacttgtgtccattaccatgagacaaaattgtgtaat |
32320530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University