View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6638_high_11 (Length: 354)
Name: NF6638_high_11
Description: NF6638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6638_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 251; Significance: 1e-139; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 11 - 277
Target Start/End: Original strand, 18645348 - 18645614
Alignment:
| Q |
11 |
aatgaaatgacaacagaaattgcttccgcattggccacatttgctacaaaatcaaggagcgtgtttcagttgtgttattgctggcacattggtatcaatc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
18645348 |
aatgaaatgacaacagaaattgcttccgcattggccacatttgctacaaaatcaaggagcgtttttcagtcgtgttattggtggcacattggtatcaatc |
18645447 |
T |
 |
| Q |
111 |
gcgcccgcaattatggtgacaaaataaaaaatctacctcggtaagacttcctggaaaaagtcctgtttcagtcatagtatccatgtcattatagccctca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18645448 |
gcgcccgcaattatggtgacaaaataaacaatctacctcggtaagacttcctggaaaaagtcctgtttcagtcatagtatccatgtcattatagccctca |
18645547 |
T |
 |
| Q |
211 |
aggagcttctcctgttgtttatagtattctgctaccttgcgttgcttctctgaaatcaaacacaacc |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18645548 |
aggagcttctcctgttgtttatagtattctgctaccttgcgttgcttctctgaaatcaaacacaacc |
18645614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 300 - 340
Target Start/End: Original strand, 18645637 - 18645677
Alignment:
| Q |
300 |
tcacttcacaaagacaatattgaattaaagtaaagcatata |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18645637 |
tcacttcacaaagacaatattgaattaaagtaaagcatata |
18645677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University