View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6638_high_17 (Length: 244)
Name: NF6638_high_17
Description: NF6638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6638_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 38792207 - 38791980
Alignment:
| Q |
1 |
tttcttcttttacttggagggttattgttagtgtttagaaggatgtttctagaaacataactaggtgtattaagaatggtcatcgtatttgattttgaaa |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |||| |||||||| |
|
|
| T |
38792207 |
tttctacttttacttggagggttattgttagtgtttagaaggatgtctctagaaacataactaggtatattaagaatggtcatcgtgtttggttttgaaa |
38792108 |
T |
 |
| Q |
101 |
atatgtttggatttgaaattatggccctttgcaaaatatcgcctccaatggttttcccgttgtccatatgcagttttctgtctctcattatgtttttgat |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38792107 |
atatgtttggatttgagattatggccctttgcaaaatatcgcctccaatggtttttccgttgtccatatggagttttctgtctctcattatgtttttgat |
38792008 |
T |
 |
| Q |
201 |
ggccgatggaactggaaattgctcaatc |
228 |
Q |
| |
|
||||||||||||||| |||||||||||| |
|
|
| T |
38792007 |
ggccgatggaactgggaattgctcaatc |
38791980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 38607409 - 38607351
Alignment:
| Q |
1 |
tttcttcttttacttggagggttattgttagtgtttagaaggatgtttctagaaacata |
59 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||| |||| || |||||||||||| |
|
|
| T |
38607409 |
tttctacttctacttggagggttattgttagtgtttaggaggacgtctctagaaacata |
38607351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University