View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6638_low_18 (Length: 251)
Name: NF6638_low_18
Description: NF6638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6638_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 41024699 - 41024453
Alignment:
| Q |
1 |
tttctatgctaacttttgtgcactggcttgaaacgggaaaacttctcgaacacaaagaagccgaggaaatgcttgggtgtatgtcttgataactcttaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41024699 |
tttctatgctaacttttgtgcactggcttgaaacgggaaaacttcttgaacacaaagaagccgaggaaatgcttgggtgtacgtcttgataactcttaat |
41024600 |
T |
 |
| Q |
101 |
agccaatactctcctgtgttattcacatgttgaatgttgttttataaatttatattatttgggtgggtaccttttatgcgtgcatatgttaatgttgtta |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41024599 |
agtcaatactctcctgtgttattcacatgttgaatgttgttttataaatttatattatttgggtgggtaccttttatgcgtgcatatgttaatgttgtta |
41024500 |
T |
 |
| Q |
201 |
ctgattactaatattaattgaatacattatgaagtcctatgcttcta |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41024499 |
ctgattactaatattaattgaatacattatgaagtcctatgattcta |
41024453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University