View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6640_high_6 (Length: 208)
Name: NF6640_high_6
Description: NF6640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6640_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 25411748 - 25411933
Alignment:
| Q |
1 |
ctcttaaatagcaaaacattagtatgaaagctg---tcatgcataagtaaaatgttttaacatccattacattatttaaaccatctccaatgcggaagct |
97 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
25411748 |
ctcttaaatagcaaaacgttagtacgaaagctgctgtcatgcataagtaaaatgttttaacatccattacattatttaaaccatctccaatggggcagct |
25411847 |
T |
 |
| Q |
98 |
ttgttcattaaccatggcacctaatataggtatctccattaggaagaaaatgagaatgatatttgtcgaatatgaggttcaactaag |
184 |
Q |
| |
|
||||||||||||| ||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25411848 |
ttgttcattaaccctggtaccaaatataggtatctccattaggaagaaaatgagaatgatatttgtcgaatatga-gttcaactaag |
25411933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University