View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6640_low_5 (Length: 326)
Name: NF6640_low_5
Description: NF6640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6640_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 12 - 139
Target Start/End: Complemental strand, 34969928 - 34969801
Alignment:
| Q |
12 |
atcatcaaccgtctcagtgccatattggtaatacaattcttttttatttaattttcaaaacatgtgaaaatctagtaacatatggtcaatatacaacaac |
111 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34969928 |
atcatcaaccgtctcagtgtcatattggtaatacaattattttttatttaattttcaaaacatgtgaaaatctagtaacacatggtcaatatacaacaac |
34969829 |
T |
|
| Q |
112 |
atagaataaagttatcaacctttttgac |
139 |
Q |
| |
|
||||||||||||||| |||||||||||| |
|
|
| T |
34969828 |
atagaataaagttataaacctttttgac |
34969801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 231 - 326
Target Start/End: Complemental strand, 34969710 - 34969615
Alignment:
| Q |
231 |
caaagtattcacataaactccggtgtcatttgaacagcttataagattcatctttacttgagtgcttgggatgtggttacaagaagtatgaatctc |
326 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34969710 |
caaagtattcacataaactccggtgtcaattgaacaacttataagattcatctttacttgagtgcttgggatgtggttataagaagtatgaatctc |
34969615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University