View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6641_high_104 (Length: 247)
Name: NF6641_high_104
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6641_high_104 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 37010488 - 37010692
Alignment:
| Q |
1 |
tgccttctataaatgttaatgttaccttgattatagttggatgatttcttgcttgtgtttgtgagaagacagcaaattctcccattagttgacatggaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37010488 |
tgccttctataaatgttaatgttaccctgattatagttggatgatttcttgcttgtgtttgtgagaagacagcaaattctcccattagttgacatggaat |
37010587 |
T |
 |
| Q |
101 |
tgacttttgggctgcattttcaattttggtactaagttgttcatactcttcctgcaaattgtnnnnnnncacaagaacccatttttagcttcacacatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37010588 |
tgacttttgggctgcattttcaattttgctactaagttgttcatactcttcctgcaaattgtaaaaaaacacaagaacccatttttagcttcacacatga |
37010687 |
T |
 |
| Q |
201 |
aggag |
205 |
Q |
| |
|
||||| |
|
|
| T |
37010688 |
aggag |
37010692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University