View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6641_high_107 (Length: 245)
Name: NF6641_high_107
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6641_high_107 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 2 - 227
Target Start/End: Original strand, 1166939 - 1167164
Alignment:
| Q |
2 |
attaagaaaaatagtctataacaacatcaataaatttaatttgacttggtcttggaggaattggtccaaggatatcactcccccaagttttgaaggtcca |
101 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1166939 |
attaagaaaaatagtctataacaactacaataaatttaatttgacttggtcttggaggaattggtccaacgatatcactcccccaagttttgaaggtcca |
1167038 |
T |
 |
| Q |
102 |
tgtaatcactatgtgatatgaatgattggcaaacctctgatactctttgattctatgcacaatttctttgcagtatgcttgtagggttggacaacaatat |
201 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1167039 |
tgtaatcactatgtgatatgaatgattggtaaacctctgatactctttgattctttgcacaatttctttgcagtatgcttgtagggttggacaacaatat |
1167138 |
T |
 |
| Q |
202 |
cctaacgtgaggactgaggacacttg |
227 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
1167139 |
cctaacgtgaggactgaggacacttg |
1167164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University