View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6641_high_117 (Length: 239)
Name: NF6641_high_117
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6641_high_117 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 12507927 - 12507705
Alignment:
| Q |
18 |
cctctccttattatggtagcaagaagtaaaattgaaagaacatgaaattcgtgtttggattaacggtaagtccaatggaatcacgatggatcactgtgat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
12507927 |
cctctccttattatggtagcaagaagtaaaattggaagaacatgaaattcgtgtttggattaacggcaagtccaatggaatcacgatggatcactctgat |
12507828 |
T |
 |
| Q |
118 |
tttggtagaaactaaactttggagaatg-nnnnnnnttatcatggtgtcaccgtgatttcgttgaaattctcctcaatccaaacatgcatgtaatgatat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12507827 |
tttggtagaaactaaactttggagaatgaaaaaaaattatcatggtgtcaccgtgatttcgttgaaattctcctcaatccaaacatgcatgtaatgatat |
12507728 |
T |
 |
| Q |
217 |
tgataatcataatggtgcttctt |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
12507727 |
tgataatcataatggtgcttctt |
12507705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University