View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6641_high_123 (Length: 231)
Name: NF6641_high_123
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6641_high_123 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 120 - 231
Target Start/End: Complemental strand, 51067691 - 51067584
Alignment:
| Q |
120 |
tccttacctatagcaagcttctgtccattctatttctattataataaaaacttacaagaatatatagtaatggaaactgtgattgtaaaagatattgtga |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51067691 |
tccttacctatagcaagcttctgtccattctatttctattataataaaaactttcaaga----atagtaatggaaactgtgattgtaaaagatattgtga |
51067596 |
T |
 |
| Q |
220 |
tcgtaggagctg |
231 |
Q |
| |
|
|||||||||||| |
|
|
| T |
51067595 |
tcgtaggagctg |
51067584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 69
Target Start/End: Complemental strand, 51067755 - 51067711
Alignment:
| Q |
24 |
atatgagtggtgttgcatcaccttgaccttttgcccaattataata |
69 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
51067755 |
atatcagtggtgttgcatcaccttgacc-tttgcccaattataata |
51067711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University