View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6641_high_130 (Length: 216)
Name: NF6641_high_130
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6641_high_130 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 20 - 203
Target Start/End: Original strand, 529949 - 530132
Alignment:
| Q |
20 |
tattggttcttctacaacacatgcttggacaaaggtacctggaaacggaccggaggttgtaatggtcatgacaaaaagatataccgatgaatcgagcatt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
529949 |
tattggttcttctacaacacatgcttggacaaaggtacctggaaacggaccggaggttgtaatggtcatgacaaaaagatatatcgatgaatcgagcatt |
530048 |
T |
 |
| Q |
120 |
gacaaacccgtcagtgtagtgctaagtgctgctacttctttttggcttccagttcctccaaggagggtgtttgattttcttcga |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
530049 |
gacaaacccgtcagtgtagtgctaagtgctgctacttctttttggcttccagttcctccaaggagggtgtttgattttcttcga |
530132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 144 - 180
Target Start/End: Original strand, 16828377 - 16828413
Alignment:
| Q |
144 |
agtgctgctacttctttttggcttccagttcctccaa |
180 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
16828377 |
agtgctgctacttctttttggcttcctgttccaccaa |
16828413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University