View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6641_high_130 (Length: 216)

Name: NF6641_high_130
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6641_high_130
NF6641_high_130
[»] chr5 (1 HSPs)
chr5 (20-203)||(529949-530132)
[»] chr4 (1 HSPs)
chr4 (144-180)||(16828377-16828413)


Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 20 - 203
Target Start/End: Original strand, 529949 - 530132
Alignment:
20 tattggttcttctacaacacatgcttggacaaaggtacctggaaacggaccggaggttgtaatggtcatgacaaaaagatataccgatgaatcgagcatt 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
529949 tattggttcttctacaacacatgcttggacaaaggtacctggaaacggaccggaggttgtaatggtcatgacaaaaagatatatcgatgaatcgagcatt 530048  T
120 gacaaacccgtcagtgtagtgctaagtgctgctacttctttttggcttccagttcctccaaggagggtgtttgattttcttcga 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
530049 gacaaacccgtcagtgtagtgctaagtgctgctacttctttttggcttccagttcctccaaggagggtgtttgattttcttcga 530132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 144 - 180
Target Start/End: Original strand, 16828377 - 16828413
Alignment:
144 agtgctgctacttctttttggcttccagttcctccaa 180  Q
    |||||||||||||||||||||||||| ||||| ||||    
16828377 agtgctgctacttctttttggcttcctgttccaccaa 16828413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University