View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6641_high_132 (Length: 213)
Name: NF6641_high_132
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6641_high_132 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 20 - 203
Target Start/End: Original strand, 14104913 - 14105093
Alignment:
| Q |
20 |
gcatatggatattattctggttctaattttctattggnnnnnnnnagagtaattttctattacttttattgttgctttgtttgatgtggcagcttgaccc |
119 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14104913 |
gcatatgaatattattctggttctaattttctattggtttttt---gagtaattttctattatttttattgttgctttgtttgatgtggcagcttgaccc |
14105009 |
T |
|
| Q |
120 |
taaatatatgggagttgatgtttcctctgggattccttgctgcaactgggtaattatgcatcttaactttccccctttgctact |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14105010 |
taaatatatgggagttgatgtttcctctgggattccttgctgcaactgggtaattatgcatcttaactttccccttttgctact |
14105093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University