View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6641_high_64 (Length: 343)
Name: NF6641_high_64
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6641_high_64 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 150 - 321
Target Start/End: Complemental strand, 35455507 - 35455337
Alignment:
| Q |
150 |
ttaaatgattagtaactaataattaccaatttgtgtttctttaagaaatctgtaatgtcgagttcgagccaatgaccacgattgtgaaatagtttctacc |
249 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||||| ||| |||||||||||||||||||||||||||||| | |||||||||| || ||| | |
|
|
| T |
35455507 |
ttaaatgattagtaactaataattacctatgtgtgtttctttatgaagtctgtaatgtcgagttcgagccaatgaccatgtttgtgaaataattccta-c |
35455409 |
T |
 |
| Q |
250 |
cctatgcttatcaaaatgctttgaagttgtagtaattaaatttgcgaatttaatgcagagatatagtgcatt |
321 |
Q |
| |
|
| |||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35455408 |
cttatgcttatcaaaatgcttttaaattgtagtaattaaatttgcgaatttaatgcagagatatagtgcatt |
35455337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 64; Significance: 6e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 13 - 100
Target Start/End: Complemental strand, 2958459 - 2958373
Alignment:
| Q |
13 |
aaaatattcgaggtttaaacattgaataggtaatcaataaatggtacaaaagatttattaggaggtgaatatgtacaagagatttagt |
100 |
Q |
| |
|
|||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
2958459 |
aaaatatttgacgtttaaacattgaataggtactcaataaatggtacaaaagatttatta-gatgtgaatatgtacaagagatttagt |
2958373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University