View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6641_high_68 (Length: 329)
Name: NF6641_high_68
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6641_high_68 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 6e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 18 - 161
Target Start/End: Complemental strand, 2551156 - 2551013
Alignment:
| Q |
18 |
cccaccaacgctaatctctttgccgatcgagcacaatcgcatatcaaactcaacgctttcactgaagctgtttctgatgctaataaggctattcaattga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2551156 |
cccaccaacgctaatctctttgccgatcgagcacaatcgcatatcaaactcaacgctttcactgaagctgtttctgatgctaataaggctattcaattga |
2551057 |
T |
 |
| Q |
118 |
atcctaatttgtctaaagcttatcttcgcaaagggtatccgtaa |
161 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2551056 |
accctaatttgtctaaagcttatcttcgcaaagggtatgcgtaa |
2551013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 234 - 321
Target Start/End: Complemental strand, 2550939 - 2550852
Alignment:
| Q |
234 |
tatttgtaggactgcttgtattaatcttgaagaatatcatactgctaaggttgcacttgaaaagggggcttcttttacacctgatgat |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2550939 |
tatttgtaggactgcttgtattaatcttgaagaatatcatactgctaaggttgcacttgaaaagggggcttcttttgcacctgatgat |
2550852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University