View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6641_high_82 (Length: 285)
Name: NF6641_high_82
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6641_high_82 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 18 - 270
Target Start/End: Original strand, 16842268 - 16842520
Alignment:
| Q |
18 |
gcatcgaatatggatggtgctgagggtgtgtttttgactttaggtgggaggattgagccggatgaaactagttatcgatcaatgattgagggttggggta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16842268 |
gcatcgaatatggatggtgctgagggtgtgtttttgactttaggtgggaggattgagccggatgaaactagttatcgatcaatgattgagggttggggta |
16842367 |
T |
|
| Q |
118 |
gagctgggaattatgaaaaggctaggtggtattatgaggagttgaagagataacggtttaagcagagttcgtctaatttgtttacgatgattaagttgca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16842368 |
gagctgggaattatgaaaaggctaggtggtattatgaggagttgaagagataacggtttaagcagagttcgtctaatttgtttacgatgattaagttgca |
16842467 |
T |
|
| Q |
218 |
agcgagtgaggatgatttggatggtttggttggtttacttgatgatatggtga |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16842468 |
agcgagtgaggatgatttggatggtttggttggtttacttgatgatatggtga |
16842520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 21 - 270
Target Start/End: Original strand, 24209110 - 24209359
Alignment:
| Q |
21 |
tcgaatatggatggtgctgagggtgtgtttttgactttaggtgggaggattgagccggatgaaactagttatcgatcaatgattgagggttggggtagag |
120 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
24209110 |
tcgaatatggatggtgctgagagtgtgtttttgagattaggtgggaggattgagccggatgaaactagttatcggtcgatgattgagggttggggtagag |
24209209 |
T |
|
| Q |
121 |
ctgggaattatgaaaaggctaggtggtattatgaggagttgaagagataacggtttaagcagagttcgtctaatttgtttacgatgattaagttgcaagc |
220 |
Q |
| |
|
| ||||||||||| ||||| |||||||||||||||||||||||||||| | ||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24209210 |
cggggaattatgagaaggcaaggtggtattatgaggagttgaagagattagggtttaagcctagttcgtctaatttgtttacaatgattaagttgcaagc |
24209309 |
T |
|
| Q |
221 |
gagtgaggatgatttggatggtttggttggtttacttgatgatatggtga |
270 |
Q |
| |
|
|| ||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
24209310 |
gaatgaggatgatttggatggtgtggttggtacacttgatgatatggtga |
24209359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University