View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6641_high_98 (Length: 251)
Name: NF6641_high_98
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6641_high_98 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 14105150 - 14105390
Alignment:
| Q |
1 |
tcttaaactacttgaatcaagacaaaaccatgaccaaaccaccaaaataatggaactattgtaaaaa--tccgttaaggttcagccgattgaactgtttt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | ||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
14105150 |
tcttaaactacttgaatcaagacaaaaccatgaccaaaccaccaaaataatcgaactctagtaaaaaaatcggttaaggttcagccgattgaactgtttt |
14105249 |
T |
 |
| Q |
99 |
attcgacttattttttaaaacgttgtctgtcgtctatactactatttacattgg-ttttcaggcgtttgtaaaaattggttaagggtcaactgattggac |
197 |
Q |
| |
|
|||||||||| ||||||||| ||||||| ||||||||||||||||||||||||| |||||| |||||||||||| ||||||| | ||| ||||| || |
|
|
| T |
14105250 |
attcgacttactttttaaaatgttgtctatcgtctatactactatttacattggtttttcacatgtttgtaaaaatcagttaaggttgaaccgattgaac |
14105349 |
T |
 |
| Q |
198 |
cgttttattcaactcaatttttaaaacattgtctatcgtct |
238 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14105350 |
tgttttattcgactcaatttttaaaacattgtctatcgtct |
14105390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 59 - 151
Target Start/End: Original strand, 14105316 - 14105408
Alignment:
| Q |
59 |
ttgtaaaaatccgttaaggttcagccgattgaactgttttattcgacttattttttaaaacgttgtctgtcgtctatactactatttacattg |
151 |
Q |
| |
|
||||||||||| ||||||||| | |||||||||||||||||||||||| | |||||||||| |||||| ||||||||| || ||||||||||| |
|
|
| T |
14105316 |
ttgtaaaaatcagttaaggttgaaccgattgaactgttttattcgactcaatttttaaaacattgtctatcgtctatattattatttacattg |
14105408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University