View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6641_low_105 (Length: 250)
Name: NF6641_low_105
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6641_low_105 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 37553745 - 37553978
Alignment:
| Q |
1 |
atcagtgattagtgttttcttctcttcattacatcatatgcattgaactgcttaaggtgcatataatttgcaacattaggaggaaagattaattagtgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37553745 |
atcagtgattagtgttttcttctcttcattacatcatatgcattgaactgcttaaggtgcatataatttgcaacattaggaggaaagattaattagtgta |
37553844 |
T |
|
| Q |
101 |
tagaatgaggatgacgattaatacatttgaggttcacgaaaggtattttcaaaggagtaacaaagctatacgtgtagatagagcaaggaagccaaattca |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37553845 |
tagaatgaggatgacgattaatacttttgaggttcacgaaaggtattttcaaaggaataacaaagctatacgtgtagatagagcaaggaagccaaattca |
37553944 |
T |
|
| Q |
201 |
agaacaaagcaagccttcaaatttgataatattc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
37553945 |
agaacaaagcaagccttcaaatttgataatattc |
37553978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University