View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6641_low_111 (Length: 246)
Name: NF6641_low_111
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6641_low_111 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 224
Target Start/End: Complemental strand, 4774870 - 4774662
Alignment:
| Q |
17 |
tgaaggaaacggtttattttattgttccgtaaacaaaaattgatatcgattcttaaaagaaagacattgatgcatttaagtaaggggaagagattatctc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4774870 |
tgaaggaaacggtttattttattgttccgtaaacaaaaattgatatcgattcttaaaagaaagacattgatgcatttaagtaaggggaagagattatctc |
4774771 |
T |
 |
| Q |
117 |
ctgcgaaatgtttctccagtaaaatcatggccacccgtctcgtcttatttatggcatacagttcaaaatattaaaa-gaaaattgaatgggggatacatc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4774770 |
ctgcgaaatgtttctccagtaaaatcatggctacccgtctcgtcttatttatggcatacaattcaaaatattaaaataaaaattgaatgggggatacatg |
4774671 |
T |
 |
| Q |
216 |
catctacct |
224 |
Q |
| |
|
||||||||| |
|
|
| T |
4774670 |
catctacct |
4774662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University