View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6641_low_116 (Length: 243)
Name: NF6641_low_116
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6641_low_116 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 17 - 243
Target Start/End: Complemental strand, 39447099 - 39446873
Alignment:
| Q |
17 |
actgtttagcatatagccttcaatttttggtgtctagcattgcatcgtgttcatatttgggcatttgatgtctttgttgatagggatttctaggtctaag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39447099 |
actgtttagcatatagccttcaatttttggtgtctagcattgcatcgtgttcatatttgggcatttgatgtctttgttgatagggatttctaggtctaag |
39447000 |
T |
 |
| Q |
117 |
tggagcaatattaattcaagtgtatcgaactgtattcaacaacaaccctatgtcatatttgctgatgctatcactcttaccacctatcaacactttgatc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39446999 |
tggagcaatattaattcaagtgtatcgaactgtattcaacaacaaccctatgtcatatttgctgatgctatcactcttaccacctatcaacactttgatc |
39446900 |
T |
 |
| Q |
217 |
cttatgtggtttgtaagaattcacaac |
243 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
39446899 |
cttatgtggtttgtaagaattcacaac |
39446873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University