View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6641_low_123 (Length: 239)
Name: NF6641_low_123
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6641_low_123 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 17 - 180
Target Start/End: Complemental strand, 12421094 - 12420933
Alignment:
| Q |
17 |
aatatttcttacattcatatgacattccacaaaattgatacacaattatattttttaattgattgatttgtgaatgacaattatttaaaagtggtacact |
116 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12421094 |
aatattttttacattcatatgacattccacaaaattgatgcacaattatatttt--aattgattgatttgtgaatgacaattatttaaaagtggtacact |
12420997 |
T |
 |
| Q |
117 |
aatttcgcacgtcttgcaagataaacacatccacatgttaaatatgaataggatgtaaattatg |
180 |
Q |
| |
|
| ||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12420996 |
actttcgcacgtcttgcaagataaatacatctacatgttaaatatgaataggatgtaaattatg |
12420933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 99 - 180
Target Start/End: Complemental strand, 12421590 - 12421509
Alignment:
| Q |
99 |
atttaaaagtggtacactaatttcgcacgtcttgcaagataaacacatccacatgttaaatatgaataggatgtaaattatg |
180 |
Q |
| |
|
|||||||| ||||||| |||||| |||||| |||||||||||| ||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
12421590 |
atttaaaaatggtacattaattttgcacgttttgcaagataaatacatcataatgttaaatatgaataggatgcaaattatg |
12421509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 226
Target Start/End: Complemental strand, 12417951 - 12417911
Alignment:
| Q |
186 |
taagcagtgaaaaagcaataccttagacaacgtgagaaaag |
226 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12417951 |
taagcagtgaaaaggcaataccttagacaacgtgagaaaag |
12417911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University