View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6641_low_135 (Length: 228)
Name: NF6641_low_135
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6641_low_135 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 7 - 222
Target Start/End: Original strand, 45363237 - 45363454
Alignment:
| Q |
7 |
tttgctccttttcctttatgattctgttcatggcaggtctgttcatggctttgcaaccgaggattatagcatgaggtaatcgcatagcagctttctctat |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45363237 |
tttgctccttttcctttatgattctgttcatggcaggtctgttcatggctttgcaaccgaggattatagcatgtggtaatcgcatagcagctttctctat |
45363336 |
T |
 |
| Q |
107 |
ggccattagattccttaccggtccagctgtcatggcagctgcttccattgttgttggactcagaggaaccctcttgcacgttgccattgttcaggtac-- |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45363337 |
ggccattagattccttaccggtccagctgtcatggcagctgcttccattgttgttggactcagaggaaccctcttgaacgttgccattgttcaggtactt |
45363436 |
T |
 |
| Q |
205 |
ttactttgatttcaacac |
222 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
45363437 |
ttactttgatttcaacac |
45363454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 40 - 202
Target Start/End: Original strand, 25041973 - 25042135
Alignment:
| Q |
40 |
caggtctgttcatggctttgcaaccgaggattatagcatgaggtaatcgcatagcagctttctctatggccattagattccttaccggtccagctgtcat |
139 |
Q |
| |
|
||||| ||||||||||||||||||| | || |||||||| || ||| ||| |||||||| || |||| | ||||||||| |||||||||||||| |
|
|
| T |
25041973 |
caggtttgttcatggctttgcaaccaaaaatcatagcatgtggaaattccattgcagctttttcaatgggtgtgagattccttgttggtccagctgtcat |
25042072 |
T |
 |
| Q |
140 |
ggcagctgcttccattgttgttggactcagaggaaccctcttgcacgttgccattgttcaggt |
202 |
Q |
| |
|
|||||||||||| ||| ||||||||||| ||| ||||| || ||||||||||||||||| |
|
|
| T |
25042073 |
ggcagctgcttcatttgctgttggactcaaaggtgttctctttcatgttgccattgttcaggt |
25042135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University