View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6641_low_138 (Length: 214)
Name: NF6641_low_138
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6641_low_138 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 21844520 - 21844328
Alignment:
| Q |
1 |
taaaggtgtgacagtaatgtcttgaggtaaggtttgtatcgttcattgtagtcttactcgattcaaacgaaaaggatgtggtagtggttaaatttcaacc |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
21844520 |
taaaggtgtgacagtagtgtcttgaggtagggtttgtatcgtccattgtagtcttactcgattcaaacgaaaaggatgtggtagtggttcaatttcaacc |
21844421 |
T |
 |
| Q |
101 |
actagtattataaccttatctggggcatagaaattttaatttgtattgtagcatttaaatttttcaaattgtttcctaattttagctataact |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21844420 |
actagtattataaccttatctggggcatagaaattttaatttgtattgtagcatttaaatttttcaaattgtttcctatttttagctataact |
21844328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University