View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6641_low_139 (Length: 213)

Name: NF6641_low_139
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6641_low_139
NF6641_low_139
[»] chr5 (1 HSPs)
chr5 (20-203)||(14104913-14105093)


Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 20 - 203
Target Start/End: Original strand, 14104913 - 14105093
Alignment:
20 gcatatggatattattctggttctaattttctattggnnnnnnnnagagtaattttctattacttttattgttgctttgtttgatgtggcagcttgaccc 119  Q
    ||||||| |||||||||||||||||||||||||||||         |||||||||||||||| |||||||||||||||||||||||||||||||||||||    
14104913 gcatatgaatattattctggttctaattttctattggtttttt---gagtaattttctattatttttattgttgctttgtttgatgtggcagcttgaccc 14105009  T
120 taaatatatgggagttgatgtttcctctgggattccttgctgcaactgggtaattatgcatcttaactttccccctttgctact 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
14105010 taaatatatgggagttgatgtttcctctgggattccttgctgcaactgggtaattatgcatcttaactttccccttttgctact 14105093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University