View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6641_low_141 (Length: 211)

Name: NF6641_low_141
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6641_low_141
NF6641_low_141
[»] chr4 (1 HSPs)
chr4 (19-200)||(22530474-22530655)


Alignment Details
Target: chr4 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 19 - 200
Target Start/End: Complemental strand, 22530655 - 22530474
Alignment:
19 gtttgggctggtttgcagttcaacggagtgtgatgtgtcgttttgagaagcgcgaatgcagaggttacggtgtcgttttgggggaaaagtgagattgacg 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22530655 gtttgggctggtttgcagttcaacggagtgtgatgtgtcgttttgagaagcgcgaatgcagaggttacggtgtcgttttgggggaaaagtgagattgacg 22530556  T
119 gtggggatgggtttaagggagtcggaaggggaagattgacggtggagattgggcggagaatgggagatgattcgtgatgatg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22530555 gtggggatgggtttaagggagtcggaaggggaagattgacggtggagattgggcggagaatgggagatgattcgtgatgatg 22530474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University