View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6641_low_142 (Length: 207)
Name: NF6641_low_142
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6641_low_142 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 17 - 195
Target Start/End: Complemental strand, 16097959 - 16097781
Alignment:
| Q |
17 |
aatctacatccttacttcctctttcatggtcactcatctcaatgattgattctaatatctctgcaatactttcaatcgtacttccccattcatggttacc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16097959 |
aatctacatccttacttcctctttcatggtcactcatctcaatgattgattccaatatctctgcaatactttcaaccgtacttccccattcatggttacc |
16097860 |
T |
 |
| Q |
117 |
cttctcaatgatggattctaatctctctacaatactttcaaccttatttccccattcatggttactcttcccaatgatg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16097859 |
cttctcaatgatggattctaatctctctacaatactttcaaccttatttccccattcatggttactcttcccaatgatg |
16097781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 29 - 195
Target Start/End: Complemental strand, 16097881 - 16097715
Alignment:
| Q |
29 |
tacttcctctttcatggtcactcatctcaatgattgattctaatatctctgcaatactttcaatcgtacttccccattcatggttacccttctcaatgat |
128 |
Q |
| |
|
||||||| | |||||||| || | |||||||||| ||||||||| ||||| |||||||||||| | || |||||||||||||||||| |||| ||||||| |
|
|
| T |
16097881 |
tacttccccattcatggttacccttctcaatgatggattctaatctctctacaatactttcaaccttatttccccattcatggttactcttcccaatgat |
16097782 |
T |
 |
| Q |
129 |
ggattctaatctctctacaatactttcaaccttatttccccattcatggttactcttcccaatgatg |
195 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||| |||||| |||| || |||| ||| ||||||| |
|
|
| T |
16097781 |
ggattctaatctctctgcaatatcttcaaccttacttccccgttcaaggctacttttcttaatgatg |
16097715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 26 - 137
Target Start/End: Complemental strand, 16097818 - 16097707
Alignment:
| Q |
26 |
ccttacttcctctttcatggtcactcatctcaatgattgattctaatatctctgcaatactttcaatcgtacttccccattcatggttacccttctcaat |
125 |
Q |
| |
|
||||| |||| | |||||||| |||| || ||||||| ||||||||| ||||||||||| ||||| | ||||||||| |||| || ||| |||| ||| |
|
|
| T |
16097818 |
ccttatttccccattcatggttactcttcccaatgatggattctaatctctctgcaatatcttcaaccttacttccccgttcaaggctacttttcttaat |
16097719 |
T |
 |
| Q |
126 |
gatggattctaa |
137 |
Q |
| |
|
|||||||||||| |
|
|
| T |
16097718 |
gatggattctaa |
16097707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University