View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6641_low_143 (Length: 205)

Name: NF6641_low_143
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6641_low_143
NF6641_low_143
[»] chr3 (1 HSPs)
chr3 (13-205)||(8945400-8945592)


Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 13 - 205
Target Start/End: Original strand, 8945400 - 8945592
Alignment:
13 aatatgaagaccatgttttgatgaaattgtggaaggttcttccatcagcaacaacatgatgaaaagctaggccaatggaaaagccataatttgggaatga 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8945400 aatatgaagaccatgttttgatgaaattgtggaaggttcttccatcagcaacaacatgatgaaaagctaggccaatggaaaagccataatttgggaatga 8945499  T
113 tgttatttgaatagctaacaaagggaactcttttacttcaaatgaaaagatttgttgcaactttggtaccaaagggtggaattcattaacatc 205  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8945500 tgttatttgaatagctaacaaagggaactcttttacttcaaatgaaaagatttgttgcaactttggtaccaaagggtggaattcattaacatc 8945592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University