View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6641_low_145 (Length: 204)

Name: NF6641_low_145
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6641_low_145
NF6641_low_145
[»] chr8 (2 HSPs)
chr8 (21-81)||(40115734-40115794)
chr8 (138-194)||(40115619-40115675)


Alignment Details
Target: chr8 (Bit Score: 57; Significance: 5e-24; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 21 - 81
Target Start/End: Complemental strand, 40115794 - 40115734
Alignment:
21 aaggttagttaccactctagttagaggactataaaatataaatatgtcacttcattgtatc 81  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
40115794 aaggttaattaccactctagttagaggactataaaatataaatatgtcacttcattgtatc 40115734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 138 - 194
Target Start/End: Complemental strand, 40115675 - 40115619
Alignment:
138 cctcatcaatacatatatgttctctatcttatttacatctatgatctttgtcctatg 194  Q
    |||||||||||||||| ||||||||||| | ||||||||||||||||||||||||||    
40115675 cctcatcaatacatatttgttctctatcatgtttacatctatgatctttgtcctatg 40115619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University