View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6641_low_32 (Length: 444)
Name: NF6641_low_32
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6641_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 175 - 430
Target Start/End: Original strand, 3760685 - 3760943
Alignment:
| Q |
175 |
gagagattcgagatggcaa-tcacaagcaaactgagtgagaagggtttgatgctgatggtaaaggcaaaggcagatcttcatccatgggaaaatgagaat |
273 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3760685 |
gagagattcgagatggcaaatcacaagcaaactgagtgagaagggtttgatgctgatggtaaaggcaaaggcagatcttcatccatgggaaaatgagaat |
3760784 |
T |
|
| Q |
274 |
agagaaagtgatccaagactaaagcttttgctttatctctttctttannnnnnnncattctaaattcttgttcctattttgaaatttacatatccccatt |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3760785 |
agagaaagtgatccaagactaaagcttttgctttatctctttctttattttttttcattctaaattcttgttcctattttgaaatttacatatccccatt |
3760884 |
T |
|
| Q |
374 |
aacttgcagat--tgtgctaccacttgttcttgacctagaccggacccaattcttagtg |
430 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3760885 |
aacttgcagattgtgtgctaccacttgttcttgacctagaccggacccaattcttagtg |
3760943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 10 - 143
Target Start/End: Original strand, 3760520 - 3760653
Alignment:
| Q |
10 |
aagaatatgatagaaagaagagtaaatggggtactttgattgttatgatcaaaagaaagtgttgttgggatacgttaattttctcgatcatgataaagca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3760520 |
aagaatatgatagaaagaagagtaaatggggtactttgattgttatgatcaaaagaaagtgttgttgggatacgttaattttctcgatcatgataaagca |
3760619 |
T |
|
| Q |
110 |
ttccaatggaaacttactgacaagaataggtttg |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
3760620 |
ttccaatggaaacttactgacaagaataggtttg |
3760653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University