View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6641_low_46 (Length: 403)
Name: NF6641_low_46
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6641_low_46 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 18 - 321
Target Start/End: Complemental strand, 13632535 - 13632227
Alignment:
| Q |
18 |
ctcttcgccctgcctcagatacgaccctggattggtgtggttgatgggtgggatgagtggatgtggagatagcatgaagattgaatcggtgtcttaacca |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| ||||||||||||||||| | |
|
|
| T |
13632535 |
ctcttcaccctgcctcagatacgaccctggattggtgtggttgatggg--------gtggatgtggagatagcatgcagagtgaatcggtgtcttaacaa |
13632444 |
T |
|
| Q |
118 |
aaaa-tgttgggttgtgttttacttat--gtggtagagttgtggagtggttcgtaagtttgaagtatgctaacatattgggtt----------agaatcg |
204 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13632443 |
aaaaatgttgggttgtgttttacttatatgtggtagagttgtggagtggtttgtaagtttgaagtatgctaacatattgggttttacgtagttagaatcg |
13632344 |
T |
|
| Q |
205 |
catgttcattctcaagtgctctccaaagaaaggtttaagtggcaatcctcctggtgtgtgaggaaggttcgtaaacacgtaaaagtcatagttacatatg |
304 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13632343 |
catgttcattctcaagcgctctccaaagaaaggtttaagtggcaatcctcctggtgtgtgaggaaggttcgtaaacacgtaaaagtcatagttacatatg |
13632244 |
T |
|
| Q |
305 |
aaattattatttttatt |
321 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
13632243 |
aaattattattattatt |
13632227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 342 - 400
Target Start/End: Complemental strand, 13632086 - 13632028
Alignment:
| Q |
342 |
atatttattaacatgttttgagataatttaataaacttcccaattctttatggtcctat |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13632086 |
atatttattaacatgttttgagataatttaataaacttcccaattctttatggtcctat |
13632028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University