View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6641_low_53 (Length: 386)
Name: NF6641_low_53
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6641_low_53 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 18 - 385
Target Start/End: Original strand, 39446490 - 39446857
Alignment:
| Q |
18 |
acaaacagaatccaaaagttcaatgtgttcactgcttggaaaagatttaggtttcctccttgttgcaaagtcctttggctgttggtatcatcagctggta |
117 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39446490 |
acaaacagaatccaaaagttcaatgttttcactgcttggaaaagatttaggtttcctccttgttgcaaagtcctttggctgttggtatcatcagctggta |
39446589 |
T |
|
| Q |
118 |
aaaggttgttggaagaatcttctcttgcaattaagttggacccttcagcaaggaaactttttgaagcgctattggaagagttcttttcgtgtgctttaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39446590 |
aaaggttgttggaagaatcttctcttgcaattaagttggacccttcagcaaggaaactttttgaagcgctattggaagagttcttttcgtgtgctttaaa |
39446689 |
T |
|
| Q |
218 |
tgcgatgcaaagaagtgaggctagcaacaccataagaacaatgaatgtaaatatgcgaattgataattgtagagtaaggatgttctctaggattatcaca |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39446690 |
tgcgatgcaaagaagtgaggctagcaacaccataagaacaatgaatgtaaatatgcgaattgataattgtagagtaaggatgttctctaggattatcaca |
39446789 |
T |
|
| Q |
318 |
atcataagatatgcggcaataactagagccatcaaagaaaatatgttgagatatttcttttctgactc |
385 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39446790 |
atcataagatatgcagcaataactagagccatcaaagaaaatatgttgagatatttcttttctgactc |
39446857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University