View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6641_low_66 (Length: 352)
Name: NF6641_low_66
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6641_low_66 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 1 - 331
Target Start/End: Original strand, 52263004 - 52263334
Alignment:
| Q |
1 |
ttccgaaatatcgccgtcgccatctccgtcgtcagcgacggcgccagctctggtcctttcaaactcaggaaaacggatcgatcaagcagggaagaagaag |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52263004 |
ttccgaaatatcaccgtcgccatctccgtcgtcagcgacggcgccagctctggtcctttcaaactcaggaaaacggatcgatcaagcagggaagaagaag |
52263103 |
T |
 |
| Q |
101 |
tacgtaaagcaagtaacgggtcgtcacaacgatactgagcttcatctagcagctcaaagaggtgatgttggtgctgtgagacagatccttcttgatattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52263104 |
tacgtaaagcaagtaacgggtcgtcacaacgatactgagcttcatctagcagctcaaagaggtgatgttggtgctgtgagacagatccttcttgatattg |
52263203 |
T |
 |
| Q |
201 |
attctcaaataatgggtactttgagtggtgatgatgatgttgatcttaacgctgagattgctgaggttcgtgctcttgttgttaatgaagagaatgaact |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52263204 |
attctcaaataatgggtactttgagtggtgatgatgatgttgatcttaacgctgagattgctgaagttcgtgctcttgttgtgaatgaagagaatgaact |
52263303 |
T |
 |
| Q |
301 |
tggtgaaactgctttgtttactgctgctgaa |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
52263304 |
tggtgaaactgctttgtttactgctgctgaa |
52263334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University