View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6641_low_85 (Length: 286)
Name: NF6641_low_85
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6641_low_85 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 23 - 247
Target Start/End: Complemental strand, 30198163 - 30197939
Alignment:
| Q |
23 |
ctttcatgttgattgttgctcatgagtggctgcttgctaattatcatagaagtagatgaggacttgaagttttactcacttgttctccttgtcgaaatac |
122 |
Q |
| |
|
||||||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30198163 |
ctttcatgttgtttgttgctcatgagtggctggttactaattatcatagaagtagatgaggacttgaagttttactcacctgttctccttgtcgaaatac |
30198064 |
T |
|
| Q |
123 |
aaatgaaacaatcatccatgttctaagatattgtgtttaaccaacctagatttggatcatgttaattgaacagtactcacctgttctctttgaattttag |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30198063 |
aaatgaaacaatcatccatgttctaagatattgtgtttaaccaacctagatttggatcatgttaattgaacagtactcacctgttctctttgaattttag |
30197964 |
T |
|
| Q |
223 |
ggacgggagtttcaactaattgaac |
247 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
30197963 |
ggacgggagtttcaactaattgaac |
30197939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University