View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6641_low_93 (Length: 266)
Name: NF6641_low_93
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6641_low_93 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 251
Target Start/End: Complemental strand, 2266394 - 2266159
Alignment:
| Q |
18 |
tgagattgaaaacacagaattcataatgtttggaagccattgcctgccaaaggcactattgcaaaggtgttagaatttggaaacttaaattcctaacact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
2266394 |
tgagattgaaaacacagaattcataatgtttggaaggcattgcctgccaaaggcactattgcaaaggtgttagaatttggaaacttgaattcccaacact |
2266295 |
T |
 |
| Q |
118 |
cattgattgannnnnnnnnattgacat-tat-agtgtttggttctaagtaacaacacgagtagcacctctcctcattggataccctgtctactccatatt |
215 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2266294 |
cattgattgatttttttttattgacatatattagtgtttggttctaagtaacaacacgagtagcacctctcctcattggataccctgtctacaccatatt |
2266195 |
T |
 |
| Q |
216 |
tggtgagcttttgtcaaagtcttgagagtgtttctt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2266194 |
tggtgagcttttgtcaaagtcttgagagtgtttctt |
2266159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University