View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6641_low_99 (Length: 255)
Name: NF6641_low_99
Description: NF6641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6641_low_99 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 36 - 248
Target Start/End: Original strand, 52383206 - 52383418
Alignment:
| Q |
36 |
tttagaaatatgctcgtgtatggctgtaattcttagtgatttcggtctctttcttagtgaaatcaatataaattagtatccaatggcatattctattttc |
135 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52383206 |
tttagaaatatgctcgtgtatggttgtaattcttagtgatttcggtctcgttcttagtgaaatcaatataaattagtatacaatggcatattctattttc |
52383305 |
T |
 |
| Q |
136 |
atatcatcaaatctgtacatatggttgaatccttttgcaagcctaatagtattctcctctgatgtaatcaccgagtcgcttcaattctccactttgttgc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52383306 |
atatcatcaaatctgtacatatggttgaatccttttgcaagcctaatagtattctcctctgatgtaatcaccgagtcgcttcaattctccactttgttgc |
52383405 |
T |
 |
| Q |
236 |
tccgtctctgctc |
248 |
Q |
| |
|
|| ||| |||||| |
|
|
| T |
52383406 |
tctgtcactgctc |
52383418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University