View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6643_low_6 (Length: 261)
Name: NF6643_low_6
Description: NF6643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6643_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 13 - 244
Target Start/End: Complemental strand, 12922145 - 12921914
Alignment:
| Q |
13 |
aatatgataacagaattttcaatgaaaacagaatgttcattcatgcatagtctgaagaaagttccatgctttagcttcctttatgtgcttatgtgcatct |
112 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12922145 |
aatatgataacagaattttcaatgataacagaattttcattcatgcatagtctgaagaaagttccatgctttagcttcctttatgtgcttatgtgcatct |
12922046 |
T |
|
| Q |
113 |
taagaggagaggatatgtgaagtatcatcattatatgcagtataactgcacaactaaacagtgaggtaattcattcagaacaatttgactggacaaagat |
212 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12922045 |
tgagaggagaggatatgtgaagtatcatcattatatgcagtataactgcacaactaaacagtgaggtaattcattcagaacaatttgactggacaaagat |
12921946 |
T |
|
| Q |
213 |
ttacgtgcagcaagatcttattcatttaatgc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12921945 |
ttacgtgcagcaagatcttattcatttaatgc |
12921914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University