View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6643_low_7 (Length: 222)
Name: NF6643_low_7
Description: NF6643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6643_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 18 - 203
Target Start/End: Original strand, 45048928 - 45049113
Alignment:
| Q |
18 |
atcaattatcactctcatcaaatcagcaaagaaatattagaaattcactcttcttcccaattttaaaatgatacttcaatcaagtatatggatttaaatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45048928 |
atcaattatcactctcatcaaatcagcaaagaaaaattagaaattcactcttcttcccaattttaaaatgatacttcaaccaagtatatggatttaaatg |
45049027 |
T |
 |
| Q |
118 |
atgtacaattttttggttagctcttaattttttaaagaagcatattggacacatctctttcttttggttttgttattagtgattct |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45049028 |
atgtacaattttttggttagctcttaattttttaaagaagcatattgcacacatctctttcttttggttttgttattagtgattct |
45049113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 161
Target Start/End: Original strand, 34025981 - 34026013
Alignment:
| Q |
129 |
tttggttagctcttaattttttaaagaagcata |
161 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
34025981 |
tttggttagctcttaatttttgaaagaagcata |
34026013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University