View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6643_low_7 (Length: 222)

Name: NF6643_low_7
Description: NF6643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6643_low_7
NF6643_low_7
[»] chr7 (1 HSPs)
chr7 (18-203)||(45048928-45049113)
[»] chr5 (1 HSPs)
chr5 (129-161)||(34025981-34026013)


Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 18 - 203
Target Start/End: Original strand, 45048928 - 45049113
Alignment:
18 atcaattatcactctcatcaaatcagcaaagaaatattagaaattcactcttcttcccaattttaaaatgatacttcaatcaagtatatggatttaaatg 117  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
45048928 atcaattatcactctcatcaaatcagcaaagaaaaattagaaattcactcttcttcccaattttaaaatgatacttcaaccaagtatatggatttaaatg 45049027  T
118 atgtacaattttttggttagctcttaattttttaaagaagcatattggacacatctctttcttttggttttgttattagtgattct 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
45049028 atgtacaattttttggttagctcttaattttttaaagaagcatattgcacacatctctttcttttggttttgttattagtgattct 45049113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 161
Target Start/End: Original strand, 34025981 - 34026013
Alignment:
129 tttggttagctcttaattttttaaagaagcata 161  Q
    ||||||||||||||||||||| |||||||||||    
34025981 tttggttagctcttaatttttgaaagaagcata 34026013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University