View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6645_high_14 (Length: 245)
Name: NF6645_high_14
Description: NF6645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6645_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 42182805 - 42183037
Alignment:
| Q |
1 |
ccaaagtgtgcttggtttcattttaattagttatgggtgagtttcgcgttcaagacaaggaacctnnnnnnnnnnccaacattgttgttgggtcggtgca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42182805 |
ccaaagtgtgcttggtttcattttaattagttatgggtgagtttcgcgttcaagacaaggaacctaaaaaaaaaaccaacattgttgttgggtcggtgca |
42182904 |
T |
 |
| Q |
101 |
gagttttgaaggtttctctaataatcatcaccaccgttcattttttcataatcatgattcttcttctgcttctgc------tgctgatggttatggtccc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42182905 |
gagttttgaaggtttctctaataatcatcaccaccgttcattttttcataatcatgattcttcttctgcttctgctgctgatgctgatggttatggtccc |
42183004 |
T |
 |
| Q |
195 |
acaacatacaacatgtcttttgggggtgattct |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42183005 |
acaacatacaacatgtcttttgggggtgattct |
42183037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University