View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6645_low_14 (Length: 256)
Name: NF6645_low_14
Description: NF6645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6645_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 19 - 254
Target Start/End: Original strand, 10561298 - 10561533
Alignment:
| Q |
19 |
gcatggatgaatattacctcaaaactttctattctaggtggcatgaaccctcttattcttgttgcataccgtcaaatctttggagctgtttccattgctc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10561298 |
gcatggatgaatattacctcaaaactttctattttaggtggcatgaaccctcttatccttgttgcataccgtcaaatctttggagctgtttccattgctc |
10561397 |
T |
 |
| Q |
119 |
cctttgcttattggattgaacgtgataaagttccaaggatgacgaaacgcattatgattcagatattgttatcttccttaacaggagtaacaggaagtca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10561398 |
cctttgcttattggattgaacgtgataaagttccaaggatgacaaaacgcattatggttcagatactgttatcttccttaacaggagtaacaggaagtca |
10561497 |
T |
 |
| Q |
219 |
gattctatatttcatagggctaaaatattcaacccc |
254 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10561498 |
gattctgtatttcatagggctaaaatattcaacccc |
10561533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 148 - 200
Target Start/End: Original strand, 45935808 - 45935860
Alignment:
| Q |
148 |
gttccaaggatgacgaaacgcattatgattcagatattgttatcttccttaac |
200 |
Q |
| |
|
|||||||||||||| || ||||||||| |||||||||||||||||||| |||| |
|
|
| T |
45935808 |
gttccaaggatgacaaagcgcattatggttcagatattgttatcttccataac |
45935860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University