View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6645_low_15 (Length: 251)
Name: NF6645_low_15
Description: NF6645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6645_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 11 - 170
Target Start/End: Original strand, 38215905 - 38216064
Alignment:
| Q |
11 |
caaaggtgttaggaataataatgtcaacatcactgctattgccattacaatgtttgatgctgcagtcttgcacccagcattatagttcacagccgaacgt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38215905 |
caaaggtgttaggaataataatgtcaacatcactgctattgccattacaatgtttgatgctgcagtcttgcacccagcattatagttcacagccgaacgc |
38216004 |
T |
|
| Q |
111 |
gaaaacggtcctgaaacaacattcaacttctatgtcacattttttagcaattgatgcaga |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38216005 |
gaaaacggtcctgaaacaacattcaacttctatgtcacattttttagcaattgatgcaga |
38216064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 11 - 126
Target Start/End: Complemental strand, 31749989 - 31749874
Alignment:
| Q |
11 |
caaaggtgttaggaataataatgtcaacatcactgctattgccattacaatgtttgatgctgcagtcttgcacccagcattatagttcacagccgaacgt |
110 |
Q |
| |
|
||||||||| | |||||| | ||||||||| ||||| |||| ||| |||||||| |||||||| |||||||| ||||||||||||||||| ||||| || |
|
|
| T |
31749989 |
caaaggtgtcaagaataacagtgtcaacatgactgcaattgacatcacaatgttggatgctgctgtcttgcatccagcattatagttcacggccgagcgc |
31749890 |
T |
|
| Q |
111 |
gaaaacggtcctgaaa |
126 |
Q |
| |
|
||||| || ||||||| |
|
|
| T |
31749889 |
gaaaatggccctgaaa |
31749874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University