View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6645_low_17 (Length: 242)
Name: NF6645_low_17
Description: NF6645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6645_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 9069250 - 9069034
Alignment:
| Q |
1 |
aaaaacttgatgtaagatctattgcaataaaataataacaagattcgacaactattcaaaatggataatatttatgagttgtcttgagctgaagaattga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9069250 |
aaaaacttgatgtaagatctattgcaataaaataataacaagattcgacaactactcaaaatggataatatttatgagttgtcttgagctgaagaattga |
9069151 |
T |
|
| Q |
101 |
aaaggtgaactacttctttgaaaacaaattatgaaaacacaattctctcctccactctagtgcttctagtagtaccaacgcttcaccaactttaacatca |
200 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9069150 |
aaaggtggactacttctttgaaaacaacttatgaaaacacaattctctcctccactctagtgcttctagtag-----------caccaactttaacatca |
9069062 |
T |
|
| Q |
201 |
acaagaggttgaagccacattgtttttg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
9069061 |
acaagaggttgaagccacattgtttttg |
9069034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University