View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6645_low_17 (Length: 242)

Name: NF6645_low_17
Description: NF6645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6645_low_17
NF6645_low_17
[»] chr6 (1 HSPs)
chr6 (1-228)||(9069034-9069250)


Alignment Details
Target: chr6 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 9069250 - 9069034
Alignment:
1 aaaaacttgatgtaagatctattgcaataaaataataacaagattcgacaactattcaaaatggataatatttatgagttgtcttgagctgaagaattga 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
9069250 aaaaacttgatgtaagatctattgcaataaaataataacaagattcgacaactactcaaaatggataatatttatgagttgtcttgagctgaagaattga 9069151  T
101 aaaggtgaactacttctttgaaaacaaattatgaaaacacaattctctcctccactctagtgcttctagtagtaccaacgcttcaccaactttaacatca 200  Q
    ||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||           |||||||||||||||||    
9069150 aaaggtggactacttctttgaaaacaacttatgaaaacacaattctctcctccactctagtgcttctagtag-----------caccaactttaacatca 9069062  T
201 acaagaggttgaagccacattgtttttg 228  Q
    ||||||||||||||||||||||||||||    
9069061 acaagaggttgaagccacattgtttttg 9069034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University