View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6645_low_18 (Length: 238)
Name: NF6645_low_18
Description: NF6645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6645_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 21 - 222
Target Start/End: Complemental strand, 3641796 - 3641595
Alignment:
| Q |
21 |
tactaatagtgatataaaatgaaaagtgtttggttaaatgagtaaaataaaatagtgggttaagagatataaatgagcaaatattcaatttggtttccaa |
120 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3641796 |
tactagtagtgatataaaatgaaaagtgtttggttaaatgagtaaaataaaatagtgggttaagagatataaatgagtaaatattcaatttggtttccaa |
3641697 |
T |
|
| Q |
121 |
agtaccaccactatatcttttatttgcttcagaactataaaaatgtaaaaattggtatctaaactattcacaatccatcaagtcagtccatgaactatca |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
3641696 |
agtaccaccactatatcttttatttgcttcagaactataaaaatgtaaaaattggtatctaaactattcacaatccatcaagttagtccataaactatca |
3641597 |
T |
|
| Q |
221 |
ca |
222 |
Q |
| |
|
|| |
|
|
| T |
3641596 |
ca |
3641595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 3650794 - 3650736
Alignment:
| Q |
1 |
ttgagaacaatcaaactaattactaatagtgatataaaatgaaaagtgtttggttaaat |
59 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||||||| | ||||||||| |
|
|
| T |
3650794 |
ttgagaacaatcaaacgaattactaatggtgatataaaatgaaaagtatctggttaaat |
3650736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University