View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6646_high_15 (Length: 282)
Name: NF6646_high_15
Description: NF6646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6646_high_15 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 13 - 282
Target Start/End: Complemental strand, 2231437 - 2231168
Alignment:
| Q |
13 |
tactaagttcgaaaatgagttttccggattgtcgttgttgataggcatatgaaacttcagtacttcactttatccgtgtatgcatacaattgataataga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2231437 |
tactaagttcgaaaatgagttttccggattgtcgttgttgataggcatatgaaacttcagtacttcactttatccgtgtatgcatacaactgataataga |
2231338 |
T |
|
| Q |
113 |
tatttactttgggaattaatgtttcttactgatattatttttctactttggaatagggtctggctgaccataaagattcattgggtgcaccactctgccc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2231337 |
tatttactttgggaattaatgtttcttactgatattatttttctactttggaatagggtctggctgaccataaagattcattgggtgcaccactctgccc |
2231238 |
T |
|
| Q |
213 |
ttgccggtaaatacttgttgttttaccttgttgtagcgttattaaatagcagctatagtgacgccttacc |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2231237 |
ttgccggtaaatacttgttgttttaccttgttgtagtgttattaaatagcagctatagtgacgccttacc |
2231168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University