View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6646_low_16 (Length: 270)
Name: NF6646_low_16
Description: NF6646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6646_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 74; Significance: 5e-34; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 5181569 - 5181476
Alignment:
| Q |
1 |
tggagaatcctagatgacaaattggtatgggaatatgattaagatgtcatttactcattgaagtcggcatactatcgcgtcaaagaggaaatgg |
94 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5181569 |
tggagaatcctagatgagaaattggtatgggaatatgataaagatggcatttactcattgaagtcggcaacctatcgcgtcaaagaggaaatgg |
5181476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 5159341 - 5159249
Alignment:
| Q |
1 |
tggagaatcctagatgacaaattggtatgggaatatgattaagatgtcatttactcattgaagtcggcatactatcgcgtcaaagaggaaatg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |||| |||||||||||||||| ||||| |
|
|
| T |
5159341 |
tggagaatcctagatgacaaattggtatgggaatatgataaagatggcatttactcattgaagttggcaacctatcgcgtcaaagagaaaatg |
5159249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 5194882 - 5194831
Alignment:
| Q |
43 |
gatgtcatttactcattgaagtcggcatactatcgcgtcaaagaggaaatgg |
94 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5194882 |
gatggcatttactcattgaagtcggcatactatcgcgtcaaagaggaaatgg |
5194831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 32 - 93
Target Start/End: Original strand, 4843278 - 4843339
Alignment:
| Q |
32 |
aatatgattaagatgtcatttactcattgaagtcggcatactatcgcgtcaaagaggaaatg |
93 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
4843278 |
aatatgataaagatggcatttactcattgaagtcggcaaactatcgcgtcaaagagaaaatg |
4843339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 95 - 133
Target Start/End: Original strand, 4843423 - 4843461
Alignment:
| Q |
95 |
aaagagtattatgtggagagtgacaaaacatattttttc |
133 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
4843423 |
aaagagtattatgtggagagtggcaaaccatattttttc |
4843461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 95 - 129
Target Start/End: Complemental strand, 5172136 - 5172102
Alignment:
| Q |
95 |
aaagagtattatgtggagagtgacaaaacatattt |
129 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
5172136 |
aaagagtattatgtggagagtggcaaaacatattt |
5172102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University