View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6646_low_23 (Length: 241)
Name: NF6646_low_23
Description: NF6646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6646_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 24 - 232
Target Start/End: Original strand, 51008384 - 51008596
Alignment:
| Q |
24 |
attcaccctctacacttcacctaccatagtaacagcctccaatatatatgcatataaacaagataatattcttgtgataattagttgcatcatgcttata |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51008384 |
attcaccctctacacttcacctaccatagtaacagcctccaatatatatgcatataaacaagataatattcttgtgataattagttgcatcatgcttata |
51008483 |
T |
 |
| Q |
124 |
agacattcattggtataagcaactttgtttctacttgatttgcttagataatatttttgg----tataagctgttttatgtatgcatatgatctaaatat |
219 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
51008484 |
agacattcattggtataagcaaatttgtttctacttgatttgcttagataatatttttggtatatataagctgttttatgtatgcatatgatctaaatat |
51008583 |
T |
 |
| Q |
220 |
tttgatgatgatg |
232 |
Q |
| |
|
||||||||||||| |
|
|
| T |
51008584 |
tttgatgatgatg |
51008596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University