View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6646_low_24 (Length: 241)
Name: NF6646_low_24
Description: NF6646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6646_low_24 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 52 - 207
Target Start/End: Complemental strand, 4036413 - 4036258
Alignment:
| Q |
52 |
ggcatcaaaaaagaaatgagtgcttttcagttaaaaataagtttctgatacttaacttacagaaaagttctacgaagcatgtagatattcataaaaggtt |
151 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || ||| |
|
|
| T |
4036413 |
ggcattaaaaaagaaatgagtgcttttcaattaaaaataagtttctgatacttaacttacagaaaagttctccgaagcatgtagatattcatataaagtt |
4036314 |
T |
|
| Q |
152 |
aaacgagttatttcaaaagttgagatgtacaaggttacaagctaattttaatttat |
207 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4036313 |
aaacgagttgttttaaaagttgagatgtacaaggttacaagctagctttaatttat |
4036258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University